PMC/PubMed Indexed Articles
Indexed In
- Open J Gate
- Genamics JournalSeek
- Academic Keys
- JournalTOCs
- CiteFactor
- Ulrich's Periodicals Directory
- Access to Global Online Research in Agriculture (AGORA)
- Electronic Journals Library
- Centre for Agriculture and Biosciences International (CABI)
- RefSeek
- Directory of Research Journal Indexing (DRJI)
- Hamdard University
- EBSCO A-Z
- OCLC- WorldCat
- Scholarsteer
- SWB online catalog
- Virtual Library of Biology (vifabio)
- Publons
- Geneva Foundation for Medical Education and Research
- Euro Pub
- Google Scholar
Useful Links
Share This Page
Journal Flyer
Open Access Journals
- Agri and Aquaculture
- Biochemistry
- Bioinformatics & Systems Biology
- Business & Management
- Chemistry
- Clinical Sciences
- Engineering
- Food & Nutrition
- General Science
- Genetics & Molecular Biology
- Immunology & Microbiology
- Medical Sciences
- Neuroscience & Psychology
- Nursing & Health Care
- Pharmaceutical Sciences
M Kamle
M Kamle
Plant Molecular Pathology Lab, Central Institute for Subtropical Horticulture,
Rehmankhera, Lucknow-227107
India
Publications
-
Research Article
A Species-Specific PCR Based Assay for Rapid Detection of Mango Anthracnose Pathogen Colletotrichum gloeosporioides Penz. and Sacc.
Author(s): M Kamle, B K Pandey, P Kumar and Muthu Kumar MM Kamle, B K Pandey, P Kumar and Muthu Kumar M
Mango (Mangifera indica L.) a fruit of nutraceutical value is accepted as the most eatable fruit crop worldwide. Mango production has been severely affected by several biotic stress mainly diseases and anthracnose is the major post-harvest disease of mango results in heavy losses. The present investigation describes PCR based assay for rapid and sensitive detection of Colletotrichum gloeosporioides causing mango anthracnose. Genus specific universal primer pair ITS1 and ITS4 was employed to amplify Colletotrichum genus which shows 560 ہ bp amplicon. The Colletotrichum gloeosporioides species-specific sequences for conserved domains were retrieved from the NCBI Genbank (sequence HM10205) and specific primers were designed. In order to validate the speciesspecific designed primer, a sensitive nested PCR assay was carried out using designed primer-pair MKCgF 5` TTGCTTCGGCGGGTAGGGTC 3` (.. View More»
DOI: 10.4172/2157-7471.1000184